Citramalate synthase yields a biosynthetic pathway for isoleucine and straight- and branched-chain ester formation in ripening apple fruit

Citramalate synthase yields a biosynthetic pathway for isoleucine and straight- and branched-chain ester formation in ripening apple fruit

Antibodies, Assay Kits, Biology Cells, Blogging, cDNA, Clia Kits, Culture Cells, Devices, Gels, Isogenic pairs of wild type and mutant induced pluripotent stem cell (iPSC) lines from Rett syndrome patients as in vitro disease model, Isotypes, MeCP2 binds to non-CG methylated DNA as neurons mature, influencing transcription and the timing of onset for Rett syndrome, Particles, PCR, Pcr Kits, Peptides Reagents, Rett syndrome: revised diagnostic criteria and nomenclature., Reward circuitry dysfunction in psychiatric and neurodevelopmental disorders and genetic syndromes: animal models and clinical findings, The genetics of autism, Twenty years of research on cytokine-induced sickness behavior. / By
A plant pathway that initiates with the formation of citramalate from pyruvate and acetyl-CoA by citramalate synthase (CMS) is proven to contribute to the synthesis of α-ketoacids and vital odor-active esters in apple (Malus × domestica) fruit. Microarray screening led to the invention of a gene with excessive amino acid similarity to 2-isopropylmalate synthase (IPMS).
However, practical evaluation of recombinant protein revealed its substrate desire differed considerably from IPMS and was extra typical of CMS. MdCMS additionally lacked the regulatory area current in MdIPMS and was not delicate to suggestions inhibition. 13C-acetate feeding of apple tissue labeled citramalate and α-ketoacids in a method in line with the presence of the citramalate pathway, labeling each straight- and branched-chain esters.
Analysis of genomic DNA (gDNA) revealed the presence of two almost an identical alleles in “Jonagold” fruit (MdCMS_1 and MdCMS_2), differing by two nonsynonymous single-nucleotide polymorphisms (SNPs). The mature proteins differed solely at amino acid 387, possessing both glutamine387 (MdCMS_1) or glutamate387 (MdCMS_2). Glutamate387 was related to close to full lack of exercise. MdCMS expression was fruit-specific, rising severalfold throughout ripening.
The translated protein product was detected in ripe fruit. Transient expression of MdCMS_1 in Nicotiana benthamiana induced the buildup of excessive ranges of citramalate, whereas MdCMS_2 didn’t. Domesticated apple traces with MdCMS isozymes containing solely glutamate387 produced a very low proportion of 2-methylbutanol- and 2-methylbutanoate (2MB) and 1-propanol and propanoate (PROP) esters. The citramalate pathway, beforehand solely described in microorganisms, is proven to operate in ripening apple and contribute to isoleucine and 2MB and PROP ester biosynthesis with out suggestions regulation.

Resolving dynamics of inertial migration in straight and curved microchannels by direct cross-sectional imaging

The explosive growth of inertial microfluidic techniques for label-free sorting and isolation of cells calls for improved understanding of the underlying physics that dictate the intriguing phenomenon of size-dependent migration in microchannels. Despite current advances in the physics underlying inertial migration, migration dynamics in 3D will not be absolutely understood. These investigations are hampered by the dearth of quick access to the channel cross part.
In this work, we report on a easy technique of direct imaging of the channel cross part that’s orthogonal to the circulation route utilizing a widespread inverted microscope, offering very important data on the 3D cross-sectional migration dynamics. We use this method to revisit particle migration in each straight and curved microchannels. In the oblong channel, the high-resolution cross-sectional pictures unambiguously affirm the two-stage migration mannequin proposed earlier.
In the curved channel, we discovered two vertical equilibrium positions and elucidate the size-dependent vertical and horizontal migration dynamics. Based on these outcomes, we suggest a vital ratio of blockage ratio (β) to Dean quantity (De) the place no web lateral migration happens (β/De ∼ 0.01). This dimensionless quantity (β/De) predicts the route of lateral migration (inward or outward) in curved and spiral channels, and thus serves as a guideline in design of such channels for particle and cell separation functions. Ultimately, the brand new method to direct imaging of the channel cross part allows a wealth of beforehand unavailable data on the dynamics of inertial migration, which serves to enhance our understanding of the underlying physics.
Citramalate synthase yields a biosynthetic pathway for isoleucine and straight- and branched-chain ester formation in ripening apple fruit

A novel vaccine adjuvant primarily based on straight polyacrylate potentiates vaccine-induced humoral and mobile immunity in cynomolgus macaques

Adjuvants are central to the efficacy of subunit vaccines. Although a number of new adjuvants have been permitted in human vaccines over the past decade, the panel of adjuvants in licensed human vaccines stays small. There remains to be a want for novel adjuvants that may be safely used in people, simple to supply and to formulate with a big selection of antigens and can be broadly relevant to a big selection of vaccines.
In this text, utilizing the Respiratory Syncytial Virus (RSV) nanoparticulate prefusion F mannequin antigen developed by Sanofi, we exhibit in the macaque mannequin that the polyacrylate (PAA)-based adjuvant SPA09 is nicely tolerated and will increase vaccine antigen-specific humoral immunity (sustained neutralizing antibodies, reminiscence B cells and mucosal immunity) and elicits robust T<sub>H</sub>1-type responses (primarily based on IFNγ and IL-2 ELISpots) in a dose-dependent method. These knowledge warrant additional growth of the SPA09 adjuvant for analysis in medical trial.

Reconstruction of the Mediastinum and Tracheopexy for Tracheomalacia in Straight-Back-Syndrome

Tracheomalacia in Straight Back Syndrome (SBS) outcomes from power compression of the trachea and the mainstem bronchi primarily as a result of decreased mediastinal diameter. Mainstay of correction is the rise of mediastinal area and the restoration of the tracheal lumen and stability. Due to the good variability of the manifestation of this illness, invidualized approaches are required.
We describe our method in a 36 12 months previous girl with SBS related extreme tracheobronchomalacia with reconstruction of the proximal aorta, brachiocephalic artery, sternoplasty and anterior tracheopexy which resulted in profitable remedy of the situation.

Authors’ response to “Straight plastic stents in tumours on the hepatic hilum and associated duodenal perforation”

We deeply recognize the attention-grabbing feedback from García Cano et al. relating to the issues derived from using plastic prostheses in hilar tumours. Indeed, a lot of the revealed case studies on duodenal perforations secondary to migrated biliary prostheses occurred with plastic stents, which can be associated to the entrapment phenomenon described. In our case, it must be clarified that, as a result of medical worsening and threat of issues related to biliary duct obstruction, we proceeded to an pressing biliary drainage by inserting a 10 Fr x 12 cm straight plastic stent.
Although it’s extensively accepted that uncovered self-expandable steel stents (SEMS) are the prostheses of option to palliate jaundice in sufferers that aren’t candidates to surgical procedure, the dearth of availability at the moment led to using a plastic stent. It should be famous that a prior analysis of liver quantity is important, in order to keep away from drainage of atrophic segments, which is related to decrease survival.
After the hostile impact described, a 12 cm SEMS was requested, which lasted for 6 months till the affected person deceased. On the opposite hand, a current publication by Wang et al. urged that the position of a nasobiliary catheter after endoscopic closure might favor the therapeutic of the perforation website and speed up restoration. Finally, we want to recall that the retroperitoneal assortment secondary to the perforation was managed percutaneously as an alternative of utilizing an endoscopic ultrasound guided drainage.

Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RD-MUSK-Hu-48Tests 48 Tests
EUR 521

Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RD-MUSK-Hu-96Tests 96 Tests
EUR 723

Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RD-MUSK-Mu-48Tests 48 Tests
EUR 533

Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RD-MUSK-Mu-96Tests 96 Tests
EUR 740

Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RDR-MUSK-Hu-48Tests 48 Tests
EUR 544

Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RDR-MUSK-Hu-96Tests 96 Tests
EUR 756

Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RDR-MUSK-Mu-48Tests 48 Tests
EUR 557

Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit
RDR-MUSK-Mu-96Tests 96 Tests
EUR 774

MuSK
GT15146 100 ug
EUR 526

MUSK/ Rat MUSK ELISA Kit
ELA-E0992r 96 Tests
EUR 886

Musk/ Rat Musk ELISA Kit
ELI-03198r 96 Tests
EUR 886

MUSK siRNA
20-abx903395
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUSK Antibody
BF0667 200ul
EUR 376
Description: MUSK antibody detects endogenous levels of total MUSK.

MuSK Antibody
AF7607 200ul
EUR 376
Description: MuSK Antibody detects endogenous levels of MuSK.

MuSK Antibody
AF7608 200ul
EUR 376
Description: MuSK Antibody detects endogenous levels of MuSK.

MUSK siRNA
20-abx925051
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUSK siRNA
20-abx925052
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUSK Antibody
ABD7040 100 ug
EUR 438

MUSK Antibody
32738-100ul 100ul
EUR 252

MuSK antibody
10R-2058 100 ul
EUR 403
Description: Mouse monoclonal MuSK antibody

MUSK Antibody
DF7040 200ul
EUR 304
Description: MUSK Antibody detects endogenous levels of total MUSK.

MUSK Antibody
1-CSB-PA989887
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUSK. Recognizes MUSK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MUSK Antibody
1-CSB-PA579873
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUSK. Recognizes MUSK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

anti-MUSK
YF-PA24187 50 ul
EUR 334
Description: Mouse polyclonal to MUSK

MUSK Blocking Peptide
BF0667-BP 1mg
EUR 195

MUSK Conjugated Antibody
C32738 100ul
EUR 397

MuSK Blocking Peptide
AF7607-BP 1mg
EUR 195

MuSK Blocking Peptide
AF7608-BP 1mg
EUR 195

MUSK cloning plasmid
CSB-CL015241HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2352
  • Sequence: ATGAGAGAGCTCGTCAACATTCCACTGGTACATATTCTTACTCTGGTTGCCTTCAGCGGAACTGAGAAACTTCCAAAAGCTCCTGTCATCACCACTCCTCTTGAAACAGTGGATGCCTTAGTTGAAGAAGTGGCTACTTTCATGTGTGCAGTGGAATCCTACCCCCAGCCTGAGA
  • Show more
Description: A cloning plasmid for the MUSK gene.

anti- MUSK antibody
FNab05442 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: muscle, skeletal, receptor tyrosine kinase
  • Uniprot ID: O15146
  • Gene ID: 4593
  • Research Area: Signal Transduction
Description: Antibody raised against MUSK

MUSK (pY755) Antibody
abx333510-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

MUSK Rabbit pAb
A2591-100ul 100 ul
EUR 308

MUSK Rabbit pAb
A2591-200ul 200 ul
EUR 459

MUSK Rabbit pAb
A2591-20ul 20 ul
EUR 183

MUSK Rabbit pAb
A2591-50ul 50 ul
EUR 223

MUSK Blocking Peptide
DF7040-BP 1mg
EUR 195

Anti-MUSK antibody
PAab05442 100 ug
EUR 412

anti-MUSK (10A4)
LF-MA30287 100 ul
EUR 486
Description: Mouse Monoclonal to MUSK

pDONR223-MUSK Plasmid
PVTB01131-1 2 ug
EUR 356

Anti-MuSK antibody
STJ98259 100 µl
EUR 234
Description: Mouse monoclonal to MuSK.

Anti-MUSK antibody
STJ24645 100 µl
EUR 277
Description: This gene encodes a muscle-specific tyrosine kinase receptor. The encoded protein may play a role in clustering of the acetylcholine receptor in the postsynaptic neuromuscular junction. Mutations in this gene have been associated with congenital myasthenic syndrome. Alternatively spliced transcript variants have been described.

Anti-MUSK (4E5)
YF-MA14333 100 ug
EUR 363
Description: Mouse monoclonal to MUSK

Anti-MUSK (4C12)
YF-MA14334 100 ug
EUR 363
Description: Mouse monoclonal to MUSK

Anti-MUSK (4C4)
YF-MA14335 100 ug
EUR 363
Description: Mouse monoclonal to MUSK

Anti-MUSK (1F3)
YF-MA10595 100 ug
EUR 363
Description: Mouse monoclonal to MUSK

Anti-MUSK (2H6)
YF-MA10596 100 ug
EUR 363
Description: Mouse monoclonal to MUSK

Rat MUSK shRNA Plasmid
20-abx986667
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-MuSK (Tyr751) Antibody
AF7107 200ul
EUR 376
Description: Phospho-MuSK (Tyr751) Antibody detects endogenous levels of MuSK only when phosphorylated at Tyr751.

Phospho-MuSK (Tyr755) Antibody
AF7108 200ul
EUR 376
Description: Phospho-MuSK (Tyr755) Antibody detects endogenous levels of MuSK only when phosphorylated at Tyr755.

Human MUSK ELISA Kit
ELA-E0992h 96 Tests
EUR 824

Chicken MUSK ELISA KIT
ELI-03196c 96 Tests
EUR 928

Mouse Musk ELISA KIT
ELI-03197m 96 Tests
EUR 865

Human MUSK ELISA KIT
ELI-03199h 96 Tests
EUR 824

MUSK ELISA KIT|Human
EF001726 96 Tests
EUR 689

Human MUSK shRNA Plasmid
20-abx953025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-MuSK Monoclonal Antibody
A00815 100ul
EUR 397
Description: Mouse Monoclonal Antibody for MuSK Antibody (MUSK) detection. Tested with IHC, IF in Human.

MuSK (Phospho-Tyr751) Antibody
12972-100ul 100ul
EUR 252

MuSK (Phospho-Tyr751) Antibody
12972-50ul 50ul
EUR 187

MuSK (Phospho-Tyr755) Antibody
11837-100ul 100ul
EUR 252

MuSK (Phospho-Tyr755) Antibody
11837-50ul 50ul
EUR 187

Mouse MUSK shRNA Plasmid
20-abx971825
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-MUSK (Tyr755) Antibody
CSB-PA204567-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-MUSK (Tyr755). Recognizes Phospho-MUSK (Tyr755) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-MUSK (Tyr755) Antibody
CSB-PA204567-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-MUSK (Tyr755). Recognizes Phospho-MUSK (Tyr755) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-MUSK (Y755) Antibody
1-CSB-PA010281
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MUSK (Y755). Recognizes Phospho-MUSK (Y755) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

pECMV-Musk-m-FLAG
PVT14418 2 ug
EUR 703

Monoclonal MUSK Antibody, Clone: 10A4
APR08577G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MUSK. The antibodies are raised in Mouse and are from clone 10A4. This antibody is applicable in IHC, ICC, E

Monoclonal Musk Antibody, Clone: 1429CT456.173.44
APR17485G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human Musk. The antibodies are raised in Mouse and are from clone 1429CT456.173.44. This antibody is applicable in WB and IHC-P, E

Polyclonal MUSK Antibody (C-term)
APR17486G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUSK (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal MUSK Antibody (N-term)
APR14296G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUSK (N-term). This antibody is tested and proven to work in the following applications:

Phospho-MuSK (Tyr751) Blocking Peptide
AF7107-BP 1mg
EUR 195

Phospho-MuSK (Tyr755) Blocking Peptide
AF7108-BP 1mg
EUR 195

MuSK (phospho Tyr755) Polyclonal Antibody
ES6294-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MuSK (phospho Tyr755) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MuSK (phospho Tyr755) Polyclonal Antibody
ES6294-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MuSK (phospho Tyr755) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MuSK (phospho Tyr755) Polyclonal Antibody
ABP55295-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human MuSK around the phosphorylation site of Y755
  • Applications tips:
Description: A polyclonal antibody for detection of MuSK phospho Tyr755) from Human, Mouse, Rat. This MuSK phospho Tyr755) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MuSK around the phosphorylation site of Y755

MuSK (phospho Tyr755) Polyclonal Antibody
ABP55295-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human MuSK around the phosphorylation site of Y755
  • Applications tips:
Description: A polyclonal antibody for detection of MuSK phospho Tyr755) from Human, Mouse, Rat. This MuSK phospho Tyr755) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MuSK around the phosphorylation site of Y755

MuSK (phospho Tyr755) Polyclonal Antibody
ABP55295-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human MuSK around the phosphorylation site of Y755
  • Applications tips:
Description: A polyclonal antibody for detection of MuSK phospho Tyr755) from Human, Mouse, Rat. This MuSK phospho Tyr755) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MuSK around the phosphorylation site of Y755

MUSK ORF Vector (Human) (pORF)
ORF025744 1.0 ug DNA
EUR 405

Musk ORF Vector (Mouse) (pORF)
ORF050790 1.0 ug DNA
EUR 506

Musk ORF Vector (Mouse) (pORF)
ORF050791 1.0 ug DNA
EUR 506

Musk ORF Vector (Mouse) (pORF)
ORF050792 1.0 ug DNA
EUR 506

Musk ORF Vector (Mouse) (pORF)
ORF050793 1.0 ug DNA
EUR 506

Musk ORF Vector (Mouse) (pORF)
ORF050794 1.0 ug DNA
EUR 506

Musk ORF Vector (Mouse) (pORF)
ORF050795 1.0 ug DNA
EUR 506

Musk ORF Vector (Rat) (pORF)
ORF070938 1.0 ug DNA
EUR 506

pECMV-Musk-m-FLAG Plasmid
PVT15350 2 ug
EUR 325

Anti-Phospho-MuSK (Y755) antibody
STJ90670 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-MuSK (Y755).

MUSK ELISA Kit (Mouse) (OKAN05935)
OKAN05935 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

MUSK ELISA Kit (Mouse) (OKCD02738)
OKCD02738 96 Wells
EUR 857
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle. Recruitment of AGRIN by LRP4 to the MUSK signaling complex induces phosphorylation and activation of MUSK, the kinase of the complex. The activation of MUSK in myotubes regulates the formation of NMJs through the regulation of different processes including the specific expression of genes in subsynaptic nuclei, the reorganization of the actin cytoskeleton and the clustering of the acetylcholine receptors (AChR) in the postsynaptic membrane. May regulate AChR phosphorylation and clustering through activation of ABL1 and Src family kinases which in turn regulate MUSK. DVL1 and PAK1 that form a ternary complex with MUSK are also important for MUSK-dependent regulation of AChR clustering. May positively regulate Rho family GTPases through FNTA. Mediates the phosphorylation of FNTA which promotes prenylation, recruitment to membranes and activation of RAC1 a regulator of the actin cytoskeleton and of gene expression. Other effectors of the MUSK signaling include DNAJA3 which functions downstream of MUSK. May also play a role within the central nervous system by mediating cholinergic responses, synaptic plasticity and memory formation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

MUSK ELISA Kit (Human) (OKCD08625)
OKCD08625 96 Wells
EUR 975
Description: Description of target: This gene encodes a muscle-specific tyrosine kinase receptor. The encoded protein may play a role in clustering of the acetylcholine receptor in the postsynaptic neuromuscular junction. Mutations in this gene have been associated with congenital myasthenic syndrome. Alternatively spliced transcript variants have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

MUSK ELISA Kit (Rat) (OKCA02571)
OKCA02571 96 Wells
EUR 846
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle . Recruitment of AGRIN by LRP4 to the MUSK signaling complex induces phosphorylation and activation of MUSK, the kinase of the complex. The activation of MUSK in myotubes regulates the formation of NMJs through the regulation of different processes including the specific expression of genes in subsynaptic nuclei, the reorganization of the actin cytoskeleton and the clustering of the acetylcholine receptors (AChR) in the postsynaptic membrane. May regulate AChR phosphorylation and clustering through activation of ABL1 and Src family kinases which in turn regulate MUSK. DVL1 and PAK1 that form a ternary complex with MUSK are also important for MUSK-dependent regulation of AChR clustering. May positively regulate Rho family GTPases through FNTA. Mediates the phosphorylation of FNTA which promotes prenylation, recruitment to membranes and activation of RAC1 a regulator of the actin cytoskeleton and of gene expression. Other effectors of the MUSK signaling include DNAJA3 which functions downstream of MUSK. May also play a role within the central nervous system by mediating cholinergic responses, synaptic plasticity and memory formation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL

MUSK ELISA Kit (Rat) (OKEH06259)
OKEH06259 96 Wells
EUR 662
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

MUSK ELISA Kit (Mouse) (OKEH07075)
OKEH07075 96 Wells
EUR 662
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle. Recruitment of AGRIN by LRP4 to the MUSK signaling complex induces phosphorylation and activation of MUSK, the kinase of the complex. The activation of MUSK in myotubes regulates the formation of NMJs through the regulation of different processes including the specific expression of genes in subsynaptic nuclei, the reorganization of the actin cytoskeleton and the clustering of the acetylcholine receptors (AChR) in the postsynaptic membrane. May regulate AChR phosphorylation and clustering through activation of ABL1 and Src family kinases which in turn regulate MUSK. DVL1 and PAK1 that form a ternary complex with MUSK are also important for MUSK-dependent regulation of AChR clustering. May positively regulate Rho family GTPases through FNTA. Mediates the phosphorylation of FNTA which promotes prenylation, recruitment to membranes and activation of RAC1 a regulator of the actin cytoskeleton and of gene expression. Other effectors of the MUSK signaling include DNAJA3 which functions downstream of MUSK. May also play a role within the central nervous system by mediating cholinergic responses, synaptic plasticity and memory formation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

MuSK (Phospho-Tyr751) Polyclonal Conjugated Antibody
C12972 100ul
EUR 397

MUSK sgRNA CRISPR Lentivector set (Human)
K2823101 3 x 1.0 ug
EUR 339

MUSK sgRNA CRISPR Lentivector set (Mouse)
K3002401 3 x 1.0 ug
EUR 339

Musk sgRNA CRISPR Lentivector set (Rat)
K6987101 3 x 1.0 ug
EUR 339

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
20-abx002025
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx145978-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) Antibody
20-abx104242
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx033586-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx033586-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx033587-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx033587-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx033588-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx033588-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx011206-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) Antibody
20-abx173640
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) Antibody
20-abx177636
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) Antibody
20-abx177637
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
20-abx214594
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
20-abx214595
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Muscle Skeletal Receptor Tyrosine Kinase (MUSK) Antibody
abx235442-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MUSK sgRNA CRISPR Lentivector (Human) (Target 1)
K2823102 1.0 ug DNA
EUR 154

MUSK sgRNA CRISPR Lentivector (Human) (Target 2)
K2823103 1.0 ug DNA
EUR 154

MUSK sgRNA CRISPR Lentivector (Human) (Target 3)
K2823104 1.0 ug DNA
EUR 154

MUSK sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3002402 1.0 ug DNA
EUR 154

MUSK sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3002403 1.0 ug DNA
EUR 154

MUSK sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3002404 1.0 ug DNA
EUR 154

Musk sgRNA CRISPR Lentivector (Rat) (Target 1)
K6987102 1.0 ug DNA
EUR 154

Musk sgRNA CRISPR Lentivector (Rat) (Target 2)
K6987103 1.0 ug DNA
EUR 154

Musk sgRNA CRISPR Lentivector (Rat) (Target 3)
K6987104 1.0 ug DNA
EUR 154

MUSK Protein Vector (Human) (pPB-C-His)
PV102974 500 ng
EUR 811

MUSK Protein Vector (Human) (pPB-N-His)
PV102975 500 ng
EUR 811

MUSK Protein Vector (Human) (pPM-C-HA)
PV102976 500 ng
EUR 811

MUSK Protein Vector (Human) (pPM-C-His)
PV102977 500 ng
EUR 811

Recombinant Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK)
4-RPE270Mu01
  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61006
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.1kDa
  • Isoelectric Point: 8.4
Description: Recombinant Mouse Muscle, Skeletal, Receptor Tyrosine Kinase expressed in: E.coli
We are conscious of the advantages of utilizing lumen-apposing steel stents in the remedy of postsurgical collections, being a beautiful different to percutaneous drainage for collections near the abdomen, duodenum or rectum. However, the restricted proof out there and our better expertise with the percutaneous approach in related collections, drove us to decide on this method.