A plant pathway that initiates with the formation of citramalate from pyruvate and acetyl-CoA by citramalate synthase (CMS) is proven to contribute to the synthesis of α-ketoacids and vital odor-active esters in apple (Malus × domestica) fruit. Microarray screening led to the invention of a gene with excessive amino acid similarity to 2-isopropylmalate synthase (IPMS).
However, practical evaluation of recombinant protein revealed its substrate desire differed considerably from IPMS and was extra typical of CMS. MdCMS additionally lacked the regulatory area current in MdIPMS and was not delicate to suggestions inhibition. 13C-acetate feeding of apple tissue labeled citramalate and α-ketoacids in a method in line with the presence of the citramalate pathway, labeling each straight- and branched-chain esters.
Analysis of genomic DNA (gDNA) revealed the presence of two almost an identical alleles in “Jonagold” fruit (MdCMS_1 and MdCMS_2), differing by two nonsynonymous single-nucleotide polymorphisms (SNPs). The mature proteins differed solely at amino acid 387, possessing both glutamine387 (MdCMS_1) or glutamate387 (MdCMS_2). Glutamate387 was related to close to full lack of exercise. MdCMS expression was fruit-specific, rising severalfold throughout ripening.
The translated protein product was detected in ripe fruit. Transient expression of MdCMS_1 in Nicotiana benthamiana induced the buildup of excessive ranges of citramalate, whereas MdCMS_2 didn’t. Domesticated apple traces with MdCMS isozymes containing solely glutamate387 produced a very low proportion of 2-methylbutanol- and 2-methylbutanoate (2MB) and 1-propanol and propanoate (PROP) esters. The citramalate pathway, beforehand solely described in microorganisms, is proven to operate in ripening apple and contribute to isoleucine and 2MB and PROP ester biosynthesis with out suggestions regulation.
Resolving dynamics of inertial migration in straight and curved microchannels by direct cross-sectional imaging
The explosive growth of inertial microfluidic techniques for label-free sorting and isolation of cells calls for improved understanding of the underlying physics that dictate the intriguing phenomenon of size-dependent migration in microchannels. Despite current advances in the physics underlying inertial migration, migration dynamics in 3D will not be absolutely understood. These investigations are hampered by the dearth of quick access to the channel cross part.
In this work, we report on a easy technique of direct imaging of the channel cross part that’s orthogonal to the circulation route utilizing a widespread inverted microscope, offering very important data on the 3D cross-sectional migration dynamics. We use this method to revisit particle migration in each straight and curved microchannels. In the oblong channel, the high-resolution cross-sectional pictures unambiguously affirm the two-stage migration mannequin proposed earlier.
In the curved channel, we discovered two vertical equilibrium positions and elucidate the size-dependent vertical and horizontal migration dynamics. Based on these outcomes, we suggest a vital ratio of blockage ratio (β) to Dean quantity (De) the place no web lateral migration happens (β/De ∼ 0.01). This dimensionless quantity (β/De) predicts the route of lateral migration (inward or outward) in curved and spiral channels, and thus serves as a guideline in design of such channels for particle and cell separation functions. Ultimately, the brand new method to direct imaging of the channel cross part allows a wealth of beforehand unavailable data on the dynamics of inertial migration, which serves to enhance our understanding of the underlying physics.
A novel vaccine adjuvant primarily based on straight polyacrylate potentiates vaccine-induced humoral and mobile immunity in cynomolgus macaques
Adjuvants are central to the efficacy of subunit vaccines. Although a number of new adjuvants have been permitted in human vaccines over the past decade, the panel of adjuvants in licensed human vaccines stays small. There remains to be a want for novel adjuvants that may be safely used in people, simple to supply and to formulate with a big selection of antigens and can be broadly relevant to a big selection of vaccines.
In this text, utilizing the Respiratory Syncytial Virus (RSV) nanoparticulate prefusion F mannequin antigen developed by Sanofi, we exhibit in the macaque mannequin that the polyacrylate (PAA)-based adjuvant SPA09 is nicely tolerated and will increase vaccine antigen-specific humoral immunity (sustained neutralizing antibodies, reminiscence B cells and mucosal immunity) and elicits robust T<sub>H</sub>1-type responses (primarily based on IFNγ and IL-2 ELISpots) in a dose-dependent method. These knowledge warrant additional growth of the SPA09 adjuvant for analysis in medical trial.
Reconstruction of the Mediastinum and Tracheopexy for Tracheomalacia in Straight-Back-Syndrome
Tracheomalacia in Straight Back Syndrome (SBS) outcomes from power compression of the trachea and the mainstem bronchi primarily as a result of decreased mediastinal diameter. Mainstay of correction is the rise of mediastinal area and the restoration of the tracheal lumen and stability. Due to the good variability of the manifestation of this illness, invidualized approaches are required.
We describe our method in a 36 12 months previous girl with SBS related extreme tracheobronchomalacia with reconstruction of the proximal aorta, brachiocephalic artery, sternoplasty and anterior tracheopexy which resulted in profitable remedy of the situation.
Authors’ response to “Straight plastic stents in tumours on the hepatic hilum and associated duodenal perforation”
We deeply recognize the attention-grabbing feedback from García Cano et al. relating to the issues derived from using plastic prostheses in hilar tumours. Indeed, a lot of the revealed case studies on duodenal perforations secondary to migrated biliary prostheses occurred with plastic stents, which can be associated to the entrapment phenomenon described. In our case, it must be clarified that, as a result of medical worsening and threat of issues related to biliary duct obstruction, we proceeded to an pressing biliary drainage by inserting a 10 Fr x 12 cm straight plastic stent.
Although it’s extensively accepted that uncovered self-expandable steel stents (SEMS) are the prostheses of option to palliate jaundice in sufferers that aren’t candidates to surgical procedure, the dearth of availability at the moment led to using a plastic stent. It should be famous that a prior analysis of liver quantity is important, in order to keep away from drainage of atrophic segments, which is related to decrease survival.
After the hostile impact described, a 12 cm SEMS was requested, which lasted for 6 months till the affected person deceased. On the opposite hand, a current publication by Wang et al. urged that the position of a nasobiliary catheter after endoscopic closure might favor the therapeutic of the perforation website and speed up restoration. Finally, we want to recall that the retroperitoneal assortment secondary to the perforation was managed percutaneously as an alternative of utilizing an endoscopic ultrasound guided drainage.
 ELISA Kit) Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RDR-MUSK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RDR-MUSK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
 ELISA Kit) Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RDR-MUSK-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RDR-MUSK-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RD-MUSK-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RD-MUSK-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RD-MUSK-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Muscle, Skeletal, Receptor Tyrosine Kinase (MUSK) ELISA Kit |
|
RD-MUSK-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
 MUSK Antibody |
|
32738-100ul |
SAB |
100ul |
EUR 252 |
 MuSK antibody |
|
10R-2058 |
Fitzgerald |
100 ul |
EUR 403 |
|
Description: Mouse monoclonal MuSK antibody |
MUSK Antibody |
|
1-CSB-PA989887 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against MUSK. Recognizes MUSK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
MUSK Antibody |
|
DF7040 |
Affbiotech |
200ul |
EUR 304 |
|
Description: MUSK Antibody detects endogenous levels of total MUSK. |
MUSK Antibody |
|
1-CSB-PA579873 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against MUSK. Recognizes MUSK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
MUSK Antibody |
|
BF0667 |
Affbiotech |
200ul |
EUR 376 |
|
Description: MUSK antibody detects endogenous levels of total MUSK. |
 MUSK siRNA |
|
20-abx903395 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUSK siRNA |
|
20-abx925051 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUSK siRNA |
|
20-abx925052 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 MuSK Antibody |
|
AF7607 |
Affbiotech |
200ul |
EUR 376 |
|
Description: MuSK Antibody detects endogenous levels of MuSK. |
MuSK Antibody |
|
AF7608 |
Affbiotech |
200ul |
EUR 376 |
|
Description: MuSK Antibody detects endogenous levels of MuSK. |
 anti-MUSK |
|
YF-PA24187 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to MUSK |
 MUSK Blocking Peptide |
|
DF7040-BP |
Affbiotech |
1mg |
EUR 195 |
 MUSK Conjugated Antibody |
|
C32738 |
SAB |
100ul |
EUR 397 |
MUSK Blocking Peptide |
|
BF0667-BP |
Affbiotech |
1mg |
EUR 195 |
 Antibody) MUSK (pY755) Antibody |
|
abx333510-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
 MuSK Blocking Peptide |
|
AF7607-BP |
Affbiotech |
1mg |
EUR 195 |
MuSK Blocking Peptide |
|
AF7608-BP |
Affbiotech |
1mg |
EUR 195 |
 MUSK cloning plasmid |
|
CSB-CL015241HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2352
- Sequence: ATGAGAGAGCTCGTCAACATTCCACTGGTACATATTCTTACTCTGGTTGCCTTCAGCGGAACTGAGAAACTTCCAAAAGCTCCTGTCATCACCACTCCTCTTGAAACAGTGGATGCCTTAGTTGAAGAAGTGGCTACTTTCATGTGTGCAGTGGAATCCTACCCCCAGCCTGAGA
- Show more
|
|
Description: A cloning plasmid for the MUSK gene. |
 MUSK Rabbit pAb |
|
A2591-100ul |
Abclonal |
100 ul |
EUR 308 |
MUSK Rabbit pAb |
|
A2591-200ul |
Abclonal |
200 ul |
EUR 459 |
MUSK Rabbit pAb |
|
A2591-20ul |
Abclonal |
20 ul |
EUR 183 |
MUSK Rabbit pAb |
|
A2591-50ul |
Abclonal |
50 ul |
EUR 223 |
 anti- MUSK antibody |
|
FNab05442 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: muscle, skeletal, receptor tyrosine kinase
- Uniprot ID: O15146
- Gene ID: 4593
- Research Area: Signal Transduction
|
|
Description: Antibody raised against MUSK |
) anti-MUSK (10A4) |
|
LF-MA30287 |
Abfrontier |
100 ul |
EUR 486 |
|
Description: Mouse Monoclonal to MUSK |
 Anti-MUSK antibody |
|
STJ24645 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a muscle-specific tyrosine kinase receptor. The encoded protein may play a role in clustering of the acetylcholine receptor in the postsynaptic neuromuscular junction. Mutations in this gene have been associated with congenital myasthenic syndrome. Alternatively spliced transcript variants have been described. |
 Anti-MuSK antibody |
|
STJ98259 |
St John's Laboratory |
100 µl |
EUR 234 |
|
Description: Mouse monoclonal to MuSK. |
) Anti-MUSK (1F3) |
|
YF-MA10595 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MUSK |
) Anti-MUSK (2H6) |
|
YF-MA10596 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MUSK |
) Anti-MUSK (4E5) |
|
YF-MA14333 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MUSK |
) Anti-MUSK (4C12) |
|
YF-MA14334 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MUSK |
) Anti-MUSK (4C4) |
|
YF-MA14335 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to MUSK |
 Antibody) MuSK (Phospho-Tyr755) Antibody |
|
11837-100ul |
SAB |
100ul |
EUR 252 |
MuSK (Phospho-Tyr755) Antibody |
|
11837-50ul |
SAB |
50ul |
EUR 187 |
 Antibody) MuSK (Phospho-Tyr751) Antibody |
|
12972-100ul |
SAB |
100ul |
EUR 252 |
MuSK (Phospho-Tyr751) Antibody |
|
12972-50ul |
SAB |
50ul |
EUR 187 |
 Antibody) Phospho-MUSK (Tyr755) Antibody |
|
CSB-PA204567- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
|
Description: A polyclonal antibody against Phospho-MUSK (Tyr755). Recognizes Phospho-MUSK (Tyr755) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-MUSK (Tyr755) Antibody |
|
CSB-PA204567-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
|
Description: A polyclonal antibody against Phospho-MUSK (Tyr755). Recognizes Phospho-MUSK (Tyr755) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
 Anti-MuSK Monoclonal Antibody |
|
A00815 |
BosterBio |
100ul |
EUR 397 |
|
Description: Mouse Monoclonal Antibody for MuSK Antibody (MUSK) detection. Tested with IHC, IF in Human. |
 Antibody) Phospho-MuSK (Tyr751) Antibody |
|
AF7107 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Phospho-MuSK (Tyr751) Antibody detects endogenous levels of MuSK only when phosphorylated at Tyr751. |
 Antibody) Phospho-MuSK (Tyr755) Antibody |
|
AF7108 |
Affbiotech |
200ul |
EUR 376 |
|
Description: Phospho-MuSK (Tyr755) Antibody detects endogenous levels of MuSK only when phosphorylated at Tyr755. |
 Mouse MUSK shRNA Plasmid |
|
20-abx971825 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat MUSK shRNA Plasmid |
|
20-abx986667 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Phospho-MUSK (Y755) Antibody |
|
1-CSB-PA010281 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against Phospho-MUSK (Y755). Recognizes Phospho-MUSK (Y755) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
 Human MUSK shRNA Plasmid |
|
20-abx953025 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Polyclonal Antibody) MuSK (phospho Tyr755) Polyclonal Antibody |
|
ABP55295-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human MuSK around the phosphorylation site of Y755
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MuSK phospho Tyr755) from Human, Mouse, Rat. This MuSK phospho Tyr755) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MuSK around the phosphorylation site of Y755 |
MuSK (phospho Tyr755) Polyclonal Antibody |
|
ABP55295-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human MuSK around the phosphorylation site of Y755
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MuSK phospho Tyr755) from Human, Mouse, Rat. This MuSK phospho Tyr755) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MuSK around the phosphorylation site of Y755 |
MuSK (phospho Tyr755) Polyclonal Antibody |
|
ABP55295-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human MuSK around the phosphorylation site of Y755
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MuSK phospho Tyr755) from Human, Mouse, Rat. This MuSK phospho Tyr755) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MuSK around the phosphorylation site of Y755 |
 Monoclonal Musk Antibody, Clone: 1429CT456.173.44 |
|
APR17485G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human Musk. The antibodies are raised in Mouse and are from clone 1429CT456.173.44. This antibody is applicable in WB and IHC-P, E |
) Polyclonal MUSK Antibody (C-term) |
|
APR17486G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUSK (C-term). This antibody is tested and proven to work in the following applications: |
 Blocking Peptide) Phospho-MuSK (Tyr751) Blocking Peptide |
|
AF7107-BP |
Affbiotech |
1mg |
EUR 195 |
 Blocking Peptide) Phospho-MuSK (Tyr755) Blocking Peptide |
|
AF7108-BP |
Affbiotech |
1mg |
EUR 195 |
) Polyclonal MUSK Antibody (N-term) |
|
APR14296G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUSK (N-term). This antibody is tested and proven to work in the following applications: |
 Monoclonal MUSK Antibody, Clone: 10A4 |
|
APR08577G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A Monoclonal antibody against Human MUSK. The antibodies are raised in Mouse and are from clone 10A4. This antibody is applicable in IHC, ICC, E |
MuSK (phospho Tyr755) Polyclonal Antibody |
|
ES6294-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MuSK (phospho Tyr755) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MuSK (phospho Tyr755) Polyclonal Antibody |
|
ES6294-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MuSK (phospho Tyr755) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 (pORF)) Musk ORF Vector (Rat) (pORF) |
|
ORF070938 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) MUSK ORF Vector (Human) (pORF) |
|
ORF025744 |
ABM |
1.0 ug DNA |
EUR 405 |
 (pORF)) Musk ORF Vector (Mouse) (pORF) |
|
ORF050790 |
ABM |
1.0 ug DNA |
EUR 506 |
Musk ORF Vector (Mouse) (pORF) |
|
ORF050791 |
ABM |
1.0 ug DNA |
EUR 506 |
Musk ORF Vector (Mouse) (pORF) |
|
ORF050792 |
ABM |
1.0 ug DNA |
EUR 506 |
Musk ORF Vector (Mouse) (pORF) |
|
ORF050793 |
ABM |
1.0 ug DNA |
EUR 506 |
Musk ORF Vector (Mouse) (pORF) |
|
ORF050794 |
ABM |
1.0 ug DNA |
EUR 506 |
Musk ORF Vector (Mouse) (pORF) |
|
ORF050795 |
ABM |
1.0 ug DNA |
EUR 506 |
 antibody) Anti-Phospho-MuSK (Y755) antibody |
|
STJ90670 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to Phospho-MuSK (Y755). |
 (OKAN05935)) MUSK ELISA Kit (Mouse) (OKAN05935) |
|
OKAN05935 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
|
Description: Description of target: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
 (OKCD02738)) MUSK ELISA Kit (Mouse) (OKCD02738) |
|
OKCD02738 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
|
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle. Recruitment of AGRIN by LRP4 to the MUSK signaling complex induces phosphorylation and activation of MUSK, the kinase of the complex. The activation of MUSK in myotubes regulates the formation of NMJs through the regulation of different processes including the specific expression of genes in subsynaptic nuclei, the reorganization of the actin cytoskeleton and the clustering of the acetylcholine receptors (AChR) in the postsynaptic membrane. May regulate AChR phosphorylation and clustering through activation of ABL1 and Src family kinases which in turn regulate MUSK. DVL1 and PAK1 that form a ternary complex with MUSK are also important for MUSK-dependent regulation of AChR clustering. May positively regulate Rho family GTPases through FNTA. Mediates the phosphorylation of FNTA which promotes prenylation, recruitment to membranes and activation of RAC1 a regulator of the actin cytoskeleton and of gene expression. Other effectors of the MUSK signaling include DNAJA3 which functions downstream of MUSK. May also play a role within the central nervous system by mediating cholinergic responses, synaptic plasticity and memory formation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL |
 (OKCA02571)) MUSK ELISA Kit (Rat) (OKCA02571) |
|
OKCA02571 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle . Recruitment of AGRIN by LRP4 to the MUSK signaling complex induces phosphorylation and activation of MUSK, the kinase of the complex. The activation of MUSK in myotubes regulates the formation of NMJs through the regulation of different processes including the specific expression of genes in subsynaptic nuclei, the reorganization of the actin cytoskeleton and the clustering of the acetylcholine receptors (AChR) in the postsynaptic membrane. May regulate AChR phosphorylation and clustering through activation of ABL1 and Src family kinases which in turn regulate MUSK. DVL1 and PAK1 that form a ternary complex with MUSK are also important for MUSK-dependent regulation of AChR clustering. May positively regulate Rho family GTPases through FNTA. Mediates the phosphorylation of FNTA which promotes prenylation, recruitment to membranes and activation of RAC1 a regulator of the actin cytoskeleton and of gene expression. Other effectors of the MUSK signaling include DNAJA3 which functions downstream of MUSK. May also play a role within the central nervous system by mediating cholinergic responses, synaptic plasticity and memory formation.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 15.6 pg/mL |
 (OKCD08625)) MUSK ELISA Kit (Human) (OKCD08625) |
|
OKCD08625 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: This gene encodes a muscle-specific tyrosine kinase receptor. The encoded protein may play a role in clustering of the acetylcholine receptor in the postsynaptic neuromuscular junction. Mutations in this gene have been associated with congenital myasthenic syndrome. Alternatively spliced transcript variants have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
 (OKEH06259)) MUSK ELISA Kit (Rat) (OKEH06259) |
|
OKEH06259 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
 (OKEH07075)) MUSK ELISA Kit (Mouse) (OKEH07075) |
|
OKEH07075 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Receptor tyrosine kinase which plays a central role in the formation and the maintenance of the neuromuscular junction (NMJ), the synapse between the motor neuron and the skeletal muscle. Recruitment of AGRIN by LRP4 to the MUSK signaling complex induces phosphorylation and activation of MUSK, the kinase of the complex. The activation of MUSK in myotubes regulates the formation of NMJs through the regulation of different processes including the specific expression of genes in subsynaptic nuclei, the reorganization of the actin cytoskeleton and the clustering of the acetylcholine receptors (AChR) in the postsynaptic membrane. May regulate AChR phosphorylation and clustering through activation of ABL1 and Src family kinases which in turn regulate MUSK. DVL1 and PAK1 that form a ternary complex with MUSK are also important for MUSK-dependent regulation of AChR clustering. May positively regulate Rho family GTPases through FNTA. Mediates the phosphorylation of FNTA which promotes prenylation, recruitment to membranes and activation of RAC1 a regulator of the actin cytoskeleton and of gene expression. Other effectors of the MUSK signaling include DNAJA3 which functions downstream of MUSK. May also play a role within the central nervous system by mediating cholinergic responses, synaptic plasticity and memory formation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
 Polyclonal Conjugated Antibody) MuSK (Phospho-Tyr751) Polyclonal Conjugated Antibody |
|
C12972 |
SAB |
100ul |
EUR 397 |
) Musk sgRNA CRISPR Lentivector set (Rat) |
|
K6987101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) MUSK sgRNA CRISPR Lentivector set (Human) |
|
K2823101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) MUSK sgRNA CRISPR Lentivector set (Mouse) |
|
K3002401 |
ABM |
3 x 1.0 ug |
EUR 339 |
We are conscious of the advantages of utilizing lumen-apposing steel stents in the remedy of postsurgical collections, being a beautiful different to percutaneous drainage for collections near the abdomen, duodenum or rectum. However, the restricted proof out there and our better expertise with the percutaneous approach in related collections, drove us to decide on this method.
